| Identification |
|---|
| Name: | Heme exporter protein D |
|---|
| Synonyms: | - Cytochrome c-type biogenesis protein CcmD
|
|---|
| Gene Name: | ccmD |
|---|
| Enzyme Class: | Not Available |
|---|
| Biological Properties |
|---|
| General Function: | Involved in transport |
|---|
| Specific Function: | Required for the export of heme to the periplasm for the biogenesis of c-type cytochromes (Potential) |
|---|
| Cellular Location: | Cell inner membrane; Single-pass membrane protein (Potential) |
|---|
| SMPDB Pathways: | Not Available |
|---|
| KEGG Pathways: | |
|---|
| EcoCyc Reactions: | |
1.0 | + | 1.0 | + | 1.0 | → | 1.0 | + | 1.0 | + | 1.0 | + | 1.0 |
| |
|
|---|
| Metabolites: | |
|---|
| GO Classification: | | Component |
|---|
| cell part | | integral to membrane | | intrinsic to membrane | | membrane part | | Process |
|---|
| establishment of localization | | transport |
|
|---|
| Gene Properties |
|---|
| Blattner: | b2198 |
|---|
| Gene Orientation | Counterclockwise |
|---|
| Centisome Percentage: | 49.43 |
|---|
| Left Sequence End | 2293399 |
|---|
| Right Sequence End | 2293608 |
|---|
| Gene Sequence: | >210 bp
ATGTCTAAGATTAAAGGTAACGTTAAGTGGTTTAATGAGTCCAAAGGATTCGGTTTCATT
ACTCCGGAAGACGGCAGCAAAGACGTGTTCGTACACTTCTCTGCAATCCAGACTAATGGT
TTTAAAACTCTTGCTGAAGGTCAGCGCGTAGAGTTCGAAATCACTAACGGTGCCAAAGGC
CCTTCTGCTGCAAACGTAATCGCTCTGTAA |
|---|
| Protein Properties |
|---|
| Pfam Domain Function: | |
|---|
| Protein Residues: | 69 |
|---|
| Protein Molecular Weight: | 7745 |
|---|
| Protein Theoretical pI: | 12 |
|---|
| Signaling Regions: | |
|---|
| Transmembrane Regions: | |
|---|
| Protein Sequence: | >Heme exporter protein D
MTPAFASWNEFFAMGGYAFFVWLAVVMTVIPLVVLVVHSVMQHRAILRGVAQQRAREARL
RAAQQQEAA |
|---|
| References |
|---|
| External Links: | |
|---|
| General Reference: | - Blattner, F. R., Plunkett, G. 3rd, Bloch, C. A., Perna, N. T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., Gregor, J., Davis, N. W., Kirkpatrick, H. A., Goeden, M. A., Rose, D. J., Mau, B., Shao, Y. (1997). "The complete genome sequence of Escherichia coli K-12." Science 277:1453-1462. Pubmed: 9278503
- Hayashi, K., Morooka, N., Yamamoto, Y., Fujita, K., Isono, K., Choi, S., Ohtsubo, E., Baba, T., Wanner, B. L., Mori, H., Horiuchi, T. (2006). "Highly accurate genome sequences of Escherichia coli K-12 strains MG1655 and W3110." Mol Syst Biol 2:2006.0007. Pubmed: 16738553
- Thony-Meyer, L., Fischer, F., Kunzler, P., Ritz, D., Hennecke, H. (1995). "Escherichia coli genes required for cytochrome c maturation." J Bacteriol 177:4321-4326. Pubmed: 7635817
|
|---|