Major outer membrane lipoprotein Lpp (P69776)

Identification
Name:Major outer membrane lipoprotein Lpp
Synonyms:
  • Braun lipoprotein
  • Murein-lipoprotein
Gene Name:lpp
Enzyme Class:Not Available
Biological Properties
General Function:Involved in lipid binding
Specific Function:Interacts with the peptidoglycan both covalently and noncovalently. This interaction contributes to the maintenance of the structural and functional integrity of the cell envelope
Cellular Location:Cell outer membrane; Lipid-anchor. Cell outer membrane; Peptidoglycan-anchor
SMPDB Pathways:Not Available
KEGG Pathways:Not Available
Complex Reactions:
1.0applipoprotein+1.0Thumb → 1.0Thumb+1.0lipoprotein
1.0applipoprotein + 1.0PE(14:0/14:0) → 1.02-Acyl-sn-glycero-3-phosphoethanolamine (N-C16:0) + 1.0lipoprotein
ReactionCard
1.0applipoprotein+1.0Thumb → 1.0Thumb+1.0lipoprotein
1.0applipoprotein + 1.0PG(16:0/16:0) → 1.02-Acyl-sn-glycero-3-phosphoglycerol (N-C16:0) + 1.0lipoprotein
ReactionCard
Metabolites:
ECMDB IDNameView
ECMDB211422-Acyl-sn-glycero-3-phosphoethanolamine (N-C16:0)MetaboCard
ECMDB211492-Acyl-sn-glycero-3-phosphoglycerol (N-C16:0)MetaboCard
ECMDB08821PE(14:0/14:0)MetaboCard
ECMDB10570PG(16:0/16:0)MetaboCard
GO Classification:
Component
cell part
membrane
outer membrane
Gene Properties
Blattner:b1677
Gene OrientationClockwise
Centisome Percentage:37.84
Left Sequence End1755445
Right Sequence End1755681
Gene Sequence:
>237 bp
ATGAGCACTATCGAAGAACGCGTTAAGAAAATTATCGGCGAACAGCTGGGCGTTAAGCAG
GAAGAAGTTACCAACAATGCTTCTTTCGTTGAAGACCTGGGCGCGGATTCTCTTGACACC
GTTGAGCTGGTAATGGCTCTGGAAGAAGAGTTTGATACTGAGATTCCGGACGAAGAAGCT
GAGAAAATCACCACCGTTCAGGCTGCCATTGATTACATCAACGGCCACCAGGCGTAA
Protein Properties
Pfam Domain Function:
Protein Residues:78
Protein Molecular Weight:8323
Protein Theoretical pI:10
PDB File:1EQ7
Signaling Regions:
  • 1-20
Transmembrane Regions:
  • None
Protein Sequence:
>Major outer membrane lipoprotein Lpp
MKATKLVLGAVILGSTLLAGCSSNAKIDQLSSDVQTLNAKVDQLSNDVNAMRSDVQAAKD
DAARANQRLDNMATKYRK
References
External Links:
ResourceLink
Uniprot ID:P69776
Uniprot Name:LPP_ECOLI
GenBank Gene ID:AP009048
Genebank Protein ID:1651537
PDB ID:1EQ7
Ecogene ID:EG10544
Ecocyc:EG10544
ColiBase:b1677
Kegg Gene:b1677
EchoBASE ID:EB0539
CCDB:LPP_ECOLI
BacMap:16129633
General Reference:
  • Aiba, H., Baba, T., Hayashi, K., Inada, T., Isono, K., Itoh, T., Kasai, H., Kashimoto, K., Kimura, S., Kitakawa, M., Kitagawa, M., Makino, K., Miki, T., Mizobuchi, K., Mori, H., Mori, T., Motomura, K., Nakade, S., Nakamura, Y., Nashimoto, H., Nishio, Y., Oshima, T., Saito, N., Sampei, G., Horiuchi, T., et, a. l. .. (1996). "A 570-kb DNA sequence of the Escherichia coli K-12 genome corresponding to the 28.0-40.1 min region on the linkage map." DNA Res 3:363-377. Pubmed: 9097039
  • Blattner, F. R., Plunkett, G. 3rd, Bloch, C. A., Perna, N. T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., Gregor, J., Davis, N. W., Kirkpatrick, H. A., Goeden, M. A., Rose, D. J., Mau, B., Shao, Y. (1997). "The complete genome sequence of Escherichia coli K-12." Science 277:1453-1462. Pubmed: 9278503
  • Braun, V., Bosch, V. (1972). "Sequence of the murein-lipoprotein and the attachment site of the lipid." Eur J Biochem 28:51-69. Pubmed: 4261992
  • Cao, G. J., Sarkar, N. (1992). "Poly(A) RNA in Escherichia coli: nucleotide sequence at the junction of the lpp transcript and the polyadenylate moiety." Proc Natl Acad Sci U S A 89:7546-7550. Pubmed: 1380161
  • Cascales, E., Bernadac, A., Gavioli, M., Lazzaroni, J. C., Lloubes, R. (2002). "Pal lipoprotein of Escherichia coli plays a major role in outer membrane integrity." J Bacteriol 184:754-759. Pubmed: 11790745
  • Choi, D. S., Yamada, H., Mizuno, T., Mizushima, S. (1986). "Trimeric structure and localization of the major lipoprotein in the cell surface of Escherichia coli." J Biol Chem 261:8953-8957. Pubmed: 3013869
  • Clavel, T., Germon, P., Vianney, A., Portalier, R., Lazzaroni, J. C. (1998). "TolB protein of Escherichia coli K-12 interacts with the outer membrane peptidoglycan-associated proteins Pal, Lpp and OmpA." Mol Microbiol 29:359-367. Pubmed: 9701827
  • Hantke, K., Braun, V. (1973). "Covalent binding of lipid to protein. Diglyceride and amide-linked fatty acid at the N-terminal end of the murein-lipoprotein of the Escherichia coli outer membrane." Eur J Biochem 34:284-296. Pubmed: 4575979
  • Hayashi, K., Morooka, N., Yamamoto, Y., Fujita, K., Isono, K., Choi, S., Ohtsubo, E., Baba, T., Wanner, B. L., Mori, H., Horiuchi, T. (2006). "Highly accurate genome sequences of Escherichia coli K-12 strains MG1655 and W3110." Mol Syst Biol 2:2006.0007. Pubmed: 16738553
  • Higgs, P. I., Letain, T. E., Merriam, K. K., Burke, N. S., Park, H., Kang, C., Postle, K. (2002). "TonB interacts with nonreceptor proteins in the outer membrane of Escherichia coli." J Bacteriol 184:1640-1648. Pubmed: 11872715
  • Inouye, S., Wang, S., Sekizawa, J., Halegoua, S., Inouye, M. (1977). "Amino acid sequence for the peptide extension on the prolipoprotein of the Escherichia coli outer membrane." Proc Natl Acad Sci U S A 74:1004-1008. Pubmed: 322142
  • Liu, J., Cao, W., Lu, M. (2002). "Core side-chain packing and backbone conformation in Lpp-56 coiled-coil mutants." J Mol Biol 318:877-888. Pubmed: 12054830
  • Liu, J., Dai, J., Lu, M. (2003). "Zinc-mediated helix capping in a triple-helical protein." Biochemistry 42:5657-5664. Pubmed: 12741822
  • Liu, J., Lu, M. (2002). "An alanine-zipper structure determined by long range intermolecular interactions." J Biol Chem 277:48708-48713. Pubmed: 12368282
  • Liu, J., Yong, W., Deng, Y., Kallenbach, N. R., Lu, M. (2004). "Atomic structure of a tryptophan-zipper pentamer." Proc Natl Acad Sci U S A 101:16156-16161. Pubmed: 15520380
  • McLachlan, A. D. (1978). "The double helix coiled coil structure of murein lipoprotein from Escherichia coli." J Mol Biol 121:493-506. Pubmed: 353292
  • Nakamura, K., Inouye, M. (1979). "DNA sequence of the gene for the outer membrane lipoprotein of E. coli: an extremely AT-rich promoter." Cell 18:1109-1117. Pubmed: 391404
  • Nakamura, K., Pirtle, R. M., Pirtle, I. L., Takeishi, K., Inouye, M. (1980). "Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. II. The complete nucleotide sequence." J Biol Chem 255:210-216. Pubmed: 6765942
  • Shu, W., Liu, J., Ji, H., Lu, M. (2000). "Core structure of the outer membrane lipoprotein from Escherichia coli at 1.9 A resolution." J Mol Biol 299:1101-1112. Pubmed: 10843861
  • Stenberg, F., Chovanec, P., Maslen, S. L., Robinson, C. V., Ilag, L. L., von Heijne, G., Daley, D. O. (2005). "Protein complexes of the Escherichia coli cell envelope." J Biol Chem 280:34409-34419. Pubmed: 16079137
  • Yakushi, T., Tajima, T., Matsuyama, S., Tokuda, H. (1997). "Lethality of the covalent linkage between mislocalized major outer membrane lipoprotein and the peptidoglycan of Escherichia coli." J Bacteriol 179:2857-2862. Pubmed: 9139900
  • Zhang, W. Y., Wu, H. C. (1992). "Alterations of the carboxyl-terminal amino acid residues of Escherichia coli lipoprotein affect the formation of murein-bound lipoprotein." J Biol Chem 267:19560-19564. Pubmed: 1527073