
Entericidin A (P0ADB4)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | Entericidin A | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | ecnA | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | response to toxic substance | ||||||||
| Specific Function: | Acts as antidote to the effect of entericidin B. | ||||||||
| Cellular Location: | Not Available | ||||||||
| SMPDB Pathways: | Not Available | ||||||||
| KEGG Pathways: | Not Available | ||||||||
| Metabolites: |
| ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Blattner: | Not Available | ||||||||
| Gene Orientation | Not Available | ||||||||
| Centisome Percentage: | Not Available | ||||||||
| Left Sequence End | Not Available | ||||||||
| Right Sequence End | Not Available | ||||||||
| Gene Sequence: | >126 atgatgaaacgccttatcgttcttgttttgcttgccagcacgctgctcacgggctgtaac accgctcgcggtttcggcgaagacatcaaacatctcggcaactccatctctcgcgctgcc agctaa | ||||||||
| Protein Properties | |||||||||
| Pfam Domain Function: | Not Available | ||||||||
| Protein Residues: | 41 | ||||||||
| Protein Molecular Weight: | 4359 | ||||||||
| Protein Theoretical pI: | Not Available | ||||||||
| Signaling Regions: |
| ||||||||
| Transmembrane Regions: | Not Available | ||||||||
| Protein Sequence: | >Entericidin A MMKRLIVLVLLASTLLTGCNTARGFGEDIKHLGNSISRAAS | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | Not Available | ||||||||