| Identification |
|---|
| Name: | Glutaredoxin-like protein NrdH |
|---|
| Synonyms: | Not Available |
|---|
| Gene Name: | nrdH |
|---|
| Enzyme Class: | Not Available |
|---|
| Biological Properties |
|---|
| General Function: | positive regulation of oxidoreductase activity |
|---|
| Specific Function: | Electron transport system for the ribonucleotide reductase system NrdEF. |
|---|
| Cellular Location: | Not Available |
|---|
| SMPDB Pathways: | Not Available |
|---|
| KEGG Pathways: | Not Available |
|---|
| Metabolites: | |
|---|
| GO Classification: | | Function |
|---|
| cell | | cell redox homeostasis | | electron carrier activity | | positive regulation of oxidoreductase activity | | protein disulfide oxidoreductase activity |
|
|---|
| Gene Properties |
|---|
| Blattner: | Not Available |
|---|
| Gene Orientation | Not Available |
|---|
| Centisome Percentage: | Not Available |
|---|
| Left Sequence End | Not Available |
|---|
| Right Sequence End | Not Available |
|---|
| Gene Sequence: | >246
atgcgcattactatttacactcgtaacgattgcgttcagtgccacgccaccaaacgggcg
atggaaaaccggggctttgattttgaaatgattaatgtcgatcgcgttcctgaagcggca
gaagcgttgcgtgctcagggctttcgtcagttgccggtagtgattgctggcgatcttagc
tggtctggtttccgtccggacatgattaaccgtctgcatccagcgccacacgcggccagt
gcatga |
|---|
| Protein Properties |
|---|
| Pfam Domain Function: | Not Available |
|---|
| Protein Residues: | 81 |
|---|
| Protein Molecular Weight: | 9139 |
|---|
| Protein Theoretical pI: | Not Available |
|---|
| PDB File: | 1H75 |
| Signaling Regions: | Not Available |
|---|
| Transmembrane Regions: | Not Available |
|---|
| Protein Sequence: | >Glutaredoxin-like protein NrdH
MRITIYTRNDCVQCHATKRAMENRGFDFEMINVDRVPEAAEALRAQGFRQLPVVIAGDLS
WSGFRPDMINRLHPAPHAASA |
|---|
| References |
|---|
| External Links: | |
|---|
| General Reference: | Not Available |
|---|
