Identification
Name:Sulfur carrier protein ThiS
Synonyms:
  • Thiamine biosynthesis protein ThiS
Gene Name:thiS
Enzyme Class:Not Available
Biological Properties
General Function:Coenzyme transport and metabolism
Specific Function:Is the sulfur donor in the synthesis of the thiazole phosphate moiety of thiamine phosphate
Cellular Location:Not Available
SMPDB Pathways:Not Available
KEGG Pathways:
Complex Reactions:
Thumb+Thumb+Thumb+Thumb+IscS with bound sulfur+ThumbThumb+Thumb+Thumb+2 Thumb+IscS sulfur acceptor protein+Thumb+Thumb
Metabolites:
ECMDB IDNameView
ECMDB012131-Deoxy-D-xylulose 5-phosphateMetaboCard
ECMDB200944-Methyl-5-(2-phosphoethyl)-thiazoleMetaboCard
ECMDB00045Adenosine monophosphateMetaboCard
ECMDB00538Adenosine triphosphateMetaboCard
ECMDB04030Carbon dioxideMetaboCard
ECMDB21328DehydroglycineMetaboCard
ECMDB21225Hydrogen ionMetaboCard
ECMDB00217NADPMetaboCard
ECMDB04111NADPHMetaboCard
ECMDB04142PyrophosphateMetaboCard
ECMDB00494WaterMetaboCard
GO Classification:
Process
cellular metabolic process
metabolic process
sulfur metabolic process
Gene Properties
Blattner:b4407
Gene OrientationCounterclockwise
Centisome Percentage:90.32
Left Sequence End4190660
Right Sequence End4190860
Gene Sequence:
>201 bp
ATGAAAGCGTATTGGGACTCTTTAACCAAAGAACAGCAGGGCGAGTTGGCCGGAAAAGTT
GGCTCAACACCTGGCTACTTACGGCTGGTTTTCAATGGCTATAAAAAAGCCAGTTTTGTG
CTGGCTAAAAAACTTGAGCAATACACATCAGGTGCAATTACGAAATCTGACTTAAGACCG
GATATCTATCCGAAAGATTAG
Protein Properties
Pfam Domain Function:
Protein Residues:66
Protein Molecular Weight:7311
Protein Theoretical pI:4
PDB File:1F0Z
Signaling Regions:
  • None
Transmembrane Regions:
  • None
Protein Sequence:
>Sulfur carrier protein ThiS
MQILFNDQAMQCAAGQTVHELLEQLDQRQAGAALAINQQIVPREQWAQHIVQDGDQILLF
QVIAGG
References
External Links:
ResourceLink
Uniprot ID:O32583
Uniprot Name:THIS_ECOLI
GenBank Gene ID:AP009048
Genebank Protein ID:85674849
PDB ID:1F0Z
Ecogene ID:EG14363
Ecocyc:EG14363
ColiBase:b4407
Kegg Gene:b4407
EchoBASE ID:EB4108
CCDB:THIS_ECOLI
BacMap:49176448
General Reference:
  • Blattner, F. R., Burland, V., Plunkett, G. 3rd, Sofia, H. J., Daniels, D. L. (1993). "Analysis of the Escherichia coli genome. IV. DNA sequence of the region from 89.2 to 92.8 minutes." Nucleic Acids Res 21:5408-5417. Pubmed: 8265357
  • Blattner, F. R., Plunkett, G. 3rd, Bloch, C. A., Perna, N. T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., Gregor, J., Davis, N. W., Kirkpatrick, H. A., Goeden, M. A., Rose, D. J., Mau, B., Shao, Y. (1997). "The complete genome sequence of Escherichia coli K-12." Science 277:1453-1462. Pubmed: 9278503
  • Hayashi, K., Morooka, N., Yamamoto, Y., Fujita, K., Isono, K., Choi, S., Ohtsubo, E., Baba, T., Wanner, B. L., Mori, H., Horiuchi, T. (2006). "Highly accurate genome sequences of Escherichia coli K-12 strains MG1655 and W3110." Mol Syst Biol 2:2006.0007. Pubmed: 16738553
  • Kelleher, N. L., Taylor, S. V., Grannis, D., Kinsland, C., Chiu, H. J., Begley, T. P., McLafferty, F. W. (1998). "Efficient sequence analysis of the six gene products (7-74 kDa) from the Escherichia coli thiamin biosynthetic operon by tandem high-resolution mass spectrometry." Protein Sci 7:1796-1801. Pubmed: 10082377
  • Lehmann, C., Begley, T. P., Ealick, S. E. (2006). "Structure of the Escherichia coli ThiS-ThiF complex, a key component of the sulfur transfer system in thiamin biosynthesis." Biochemistry 45:11-19. Pubmed: 16388576
  • Taylor, S. V., Kelleher, N. L., Kinsland, C., Chiu, H. J., Costello, C. A., Backstrom, A. D., McLafferty, F. W., Begley, T. P. (1998). "Thiamin biosynthesis in Escherichia coli. Identification of ThiS thiocarboxylate as the immediate sulfur donor in the thiazole formation." J Biol Chem 273:16555-16560. Pubmed: 9632726
  • Vander Horn, P. B., Backstrom, A. D., Stewart, V., Begley, T. P. (1993). "Structural genes for thiamine biosynthetic enzymes (thiCEFGH) in Escherichia coli K-12." J Bacteriol 175:982-992. Pubmed: 8432721
  • Wang, C., Xi, J., Begley, T. P., Nicholson, L. K. (2001). "Solution structure of ThiS and implications for the evolutionary roots of ubiquitin." Nat Struct Biol 8:47-51. Pubmed: 11135670
  • Xi, J., Ge, Y., Kinsland, C., McLafferty, F. W., Begley, T. P. (2001). "Biosynthesis of the thiazole moiety of thiamin in Escherichia coli: identification of an acyldisulfide-linked protein--protein conjugate that is functionally analogous to the ubiquitin/E1 complex." Proc Natl Acad Sci U S A 98:8513-8518. Pubmed: 11438688